#!/usr/bin/perl

### CVS: added the option -mask

############################################################
#
# $Id: dna-pattern,v 1.63 2011/03/28 12:41:12 jvanheld Exp $
#
# Time-stamp: <2003-08-13 12:16:03 jvanheld>
#
############################################################
if ($0 =~ /([^(\/)]+)$/) {
    push (@INC, "$`lib/");
}
require "RSA.lib";
require RSAT::pattern;
require RSAT::match;
&InitMatchScores();

$start_time = &RSAT::util::StartScript();

#### init variables ####
@matches = (); ## Empty match list before analyzing the next sequence
$merge_matches = 0;
$pattern_score = 1;
$noid = 0;
$strands_to_search = "DR";
$in_format = "fasta";
$match_format = "table";
#$search_method = "IUPAC";
$search_method = "regexp";

## Return fields
%supported_return_fields = (
    sites=>1,
    limits=>1,
    notacgt=>1,
    counts=>1,
    ct=>1,
    table=>1,
    scores=>1,
    rank=>1,
    colsum=>1,
    rowsum=>1,
    total=>1,
    stats=>1,
    profiles=>1,
    );
$supported_return_fields = join (",", sort(keys( %supported_return_fields)));
%return_fields = ();

if ($HelpRequested) {
    &Help;
    exit;
}


&ReadArguments();

################################################################
#
# check parameter values 
#

#### return values
unless (%return_fields) {
    $return_fields{sites} = 1;
}

## Dependencies between the fields
if ($calc{table}) {
    $calc{counts} = 1;
}
if ($calc{scores}) {
    $calc{counts} = 1;
}
if ($calc{total}) {
    $calc{colsum} = 1;
    $calc{rowsum} = 1;
}
if ($return_fields{total}) {
  $return_fields{colsum} = 1;
  $return_fields{rowsum} = 1;
}
if ($calc{stats}) {
    $calc{colsum} = 1;
    $calc{rowsum} = 1;
}


#### top scores only valid with sliding window
if (($return_fields{top} ) && !($search_method eq "sliding window")) {
    &RSAT::error::FatalError("The option -top is only valid with the option -window\n");
}
#if (($sort ) && !($return_fields{top})) {
#    &RSAT::error::FatalError("The option -sort is only vlid with the option -top\n");
#}


&RSAT::message::Info("Fields to return", join( ";", sort (keys (%return_fields)))) if ($main::verbose >= 4);
&RSAT::message::Info("Fields to calculate", join( ";", sort(keys (%calc)))) if ($main::verbose >= 4);

#### check allowed substitutions ####
unless (($allowed_subst eq "") || (&IsNatural($allowed_subst))) {
    &RSAT::error::FatalError("Invalid number of allowed substitutions.\n");
}

### check input format 
&CheckInputSeqFormat($in_format);

@patterns = &ReadPatterns(pattern_file=>$pattern_file, 
			  score_column=>$score_column, 
			  noid=>$noid,
			  pattern_score=>$pattern_score,
			  pattern_id=>$pattern_id,
			  pattern_seq=>$pattern_seq,
			  );

@patterns = sort {$b->get_attribute("score") <=> $a->get_attribute("score")} @patterns;


#### check patterns
if ($main::verbose >= 2) {
    warn "Patterns\n";
    foreach my $pattern (@patterns) {
	warn join ("\t", 
		   $pattern->get_attribute("sequence"),
		   $pattern->get_attribute("id"),
		   $pattern->get_attribute("score"),
		   ), "\n";
    }
}

### no pattern specified
if ($#patterns < 0) {
    &Warning("There is not a single pattern.") ;
    exit(0);
}

#### prepare pattern hash for sliding window 
%pattern_scores = ();
%pattern_lengths = ();
if ($search_method eq "sliding window") {
    #### calculate pattern length
    my $first_pattern_seq =  $patterns[0]->get_attribute("sequence");
    $pattern_length = length($first_pattern_seq);

    foreach my $pattern (@patterns) {
	my $pattern_seq = lc($pattern->get_attribute("sequence"));
	
	#### index pattern length
	$pattern_lengths{length($pattern_seq)}++;
	
	#### check pattern length
#	if (length($pattern_seq) != $pattern_length) {
#	    &RSAT::error::FatalError("With the sliding window option, all patterns must have the same length");
#	}
	
	#### check non-degeneracy
	if ($pattern_seq =~ /[^acgt]/i) { &RSAT::error::FatalError("With the sliding window option, only non-degenerate DNA alphabet is supported [ACGT]\n") };

	#### index pattern score
	my $pattern_score = $pattern->get_attribute("score");
	$pattern_scores{$pattern_seq} = $pattern_score;
    }

    #### two strand search
    if ($strands_to_search eq "DR") {
	foreach my $pattern_seq (keys %pattern_scores) {
	    $pattern_scores{lc(&ReverseComplement($pattern_seq))} = $pattern_scores{$pattern_seq};
	}
	$strand = "DR";
    } else {
	$strand = "D";
    }

    #### create an object for the composite pattern
    $pattern = new RSAT::pattern(id => "composite",
				 sequence => "*composite*",
				 score => $pattern_score,
				 min_length=>&min(keys(%pattern_lengths)),
				 max_length=>&max(keys(%pattern_lengths)),
				);

}

### open output file ###
$out = &OpenOutputFile($outputfile);

&Verbose if ($verbose >=1);

#### search ###
### open sequence file ###
($in, $input_dir) = &OpenInputFile($inputfile);

### read input sequences
while ((($current_seq, $sequence_id, @comments) = &ReadNextSequence($in, $in_format, $input_dir, "", $mask)) &&
       (($current_seq) || ($sequence_id))) {
    push @sequence_ids, $sequence_id;

    #### remove tabs and blank spaces ####    
    $current_seq = &FoldSequence($current_seq, 0);

    $sequence_length = length($current_seq);


    #### verbose
    $s++;
    &RSAT::message::Info(join ("\t", "; Scanning sequence", $s, $sequence_id, $sequence_length)) if ($verbose >= 2);

#    &RSAT::message::Debug($sequence_id, $current_seq) if ($main::verbose >= 10);

    if (($origin <  0) || ($origin eq "-0")) {
	$orig_pos = $sequence_length + $origin + 1;
    } else {
	$orig_pos = $origin;
    }

    ## Print sequence limits
    &PrintSequenceLimits($sequence_id, $sequence_length, $orig_pos) if ($return_fields{limits});

    ## Search for characters that do not correspond to ATGC
   if ($return_fields{notacgt}){
   		$pattern = new RSAT::pattern(id=>"notACGT",
						description=>"notACGT",
						sequence=>"[^ACGT]+",
						score=>"1",
					       );
		$regular_expression = $pattern->get_attribute("sequence");
		$regular_expression =~ tr/a-z/A-Z/;
	    $pattern_length = length($regular_expression);
	    $strand = "D";
	    my $initial_noov = $no_overlap;
	    unless ($initial_noov){
	    	$no_overlap = 1;
	    	}
   		&RegExpSearch($current_seq, $regular_expression);
   		unless ($initial_noov){
	    	$no_overlap = 0;
	    	}
   }

    if ($search_method eq "sliding window") {
	&SlidingWindowSearch();
    } else {
	foreach $pattern (@patterns) {
	    $expression = $pattern->get_attribute("sequence");
	    $expression =~ tr/a-z/A-Z/;
	    $pattern_length = length($expression);
	    unless ($noIUPAC){
	    	$D_regular_expression = &IUPAC_to_regular($expression);
	    	$R_regular_expression = &ReverseComplement($D_regular_expression);
	    	$RC_pattern = &ReverseComplement($expression);
	    } else {
	    	$D_regular_expression = $expression;
	    	$R_regular_expression = $expression;
	    	}
	    
	    $match_count = 0;
	    #### palindromic patterns are searched only  on one strand 
	    if (($expression eq &ReverseComplement($expression)) && 
		($strands_to_search eq "DR")) {
		$regular_expression = $D_regular_expression;
		$strand = "DR";
		if ($search_method eq "regexp") {
		    &RegExpSearch($current_seq, $regular_expression);
		} else {
		    &IUPACsearch();
		}
	    } else { 

		#### search on direct strand
		if ($strands_to_search =~ /D/) {
		    $regular_expression = $D_regular_expression;
		    $strand = "D";
		    if ($search_method eq "regexp") {
			&RegExpSearch($current_seq, $regular_expression);
		    } else {
			&IUPACsearch();
		    }
		}
		#### search on reverse complement strand
		if ($strands_to_search =~ /R/) {
		    $regular_expression = $R_regular_expression;
		    $strand = "R";
		    if ($search_method eq "regexp") {
			&RegExpSearch($current_seq, $regular_expression);
		    } else {
			&IUPACsearch();
		    }
		}
	    }
	    
	    #### increment the total counter for the pattern
	    $sum_per_pattern{$pattern} += $match_count;
	    $sum_per_sequence{$sequence_id} += $match_count;
	    $score_per_sequence{$sequence_id} += $match_count*$pattern->get_attribute("score");
	    $total_sum += $match_count;
	    
	    #### store match count if requested
	    if ($calc{counts}) {
		$match_count{$sequence_id}{$pattern} = $match_count;
	    }
	    &RSAT::message::Debug("match counts", 
				  "seq", $sequence_id, $sum_per_sequence{$sequence_id},
				  "pattern", $pattern->get_attribute("id"), $sum_per_pattern{$pattern},
				  $match_count{$sequence_id}{$pattern}) if ($main::verbose >= 5);
	}
    }

    if ($merge_matches) {
	my @merged_matches = &MergeMatches(@matches);
	&PrintMatchLocations(@merged_matches);
	@matches = ()
    }
}


&MatchProfiles() if ($return_fields{profiles});

&MatchCounts if ($return_fields{counts});

&TopScores if ($return_fields{top});


&CountTable if (($return_fields{table}) || ($return_fields{scores}));

&MatchingStatistics() if ($return_fields{stats});


################################################################
## Close output stream
my $exec_time = &RSAT::util::ReportExecutionTime($start_time); ## This has to be exectuted by all scripts
print $main::out $exec_time if ($main::verbose >= 1); ## only report exec time if verbosity is specified
close $main::out if ($main::outfile{output});


################################################################
#################### subroutine definition #####################
################################################################


################################################################
# search with a regular expression
#
sub RegExpSearch {
    my %pat_hash = &Substitute($regular_expression, $allowed_subst, 0);
    my @keys = sort {
	($pat_hash{$a} > $pat_hash{$b}) ||
	    (($pat_hash{$a} == $pat_hash{$b}) and
	     (lc($a) cmp lc($b)))
	    } keys %pat_hash;
    foreach my $regular_pattern (@keys) {
	$seq_to_crop = $current_seq;
	while ($seq_to_crop =~ /($regular_pattern)(.*)/i) {
#	    &RSAT::message::Debug("Matching pattern", $regular_pattern, $seq_to_crop) if ($main::verbose >= 10);
	    $match_count++;
#	    if ($strand eq "DR") {
#		$match_count++;
#	    }
	    $matching_seq = $1;
	    $matching_seq_length = length($matching_seq);
	    $remaining_seq = $2;
	    $remaining_seq_len =  length($remaining_seq);
	    $offset = $matching_seq_length + $remaining_seq_len -1;

#	    &RSAT::message::Debug("Offset calculation", 
#				  "match len:".$matching_seq_length, 
#				  "remaining len:".$remaining_seq_len, 
#				  "offset:".$offset, 
#				  "matching:".$matching_seq, 
#				  "remaining:".$remaining_seq) if ($main::verbose >= 0);
	    $up_flank = "";
	    $down_flank = "";
	    if ($return_fields{sites}) {
		if ($strand eq "R") {
#		    $matching_seq = &ReverseComplement($matching_seq);
		    $up_flanking = $right_flanking;
		    $down_flanking = $left_flanking;
		} else {
		    $up_flanking = $left_flanking;
		    $down_flanking = $right_flanking;
		}
		if (($left_flanking) || ($right_flanking)){
		    $up_flank = substr($current_seq,-$offset-$up_flanking-1,$up_flanking);
		    $down_flank = substr($current_seq,-$offset+$matching_seq_length-1,$down_flanking);
		    
#		    if ($strand eq "R") {
#			$up_flank = &ReverseComplement($up_flank);
#			$down_flank = &ReverseComplement($down_flank);
#			$matching_seq = lc($down_flank).uc($matching_seq).lc($up_flank);
#		    } else {
#			$matching_seq = lc($up_flank).uc($matching_seq).lc($down_flank);
#		    }
		    
		}
		$start_pos = $sequence_length - $offset - $orig_pos;
		$end_pos = $start_pos + $matching_seq_length - 1;
		$mismatches = $pat_hash{$regular_pattern};
		
		my $match = new RSAT::match();
		$match->set_attribute("type", "regexp");
		$match->set_attribute("pattern_id", $pattern->get_attribute("id"));
		$match->set_attribute("pattern_seq", $pattern->get_attribute("sequence"));
		$match->set_attribute("expression", $regular_pattern);
		$match->set_attribute("sequence_id", $sequence_id);
		$match->set_attribute("start_pos", $start_pos);
		$match->set_attribute("end_pos", $end_pos);
		$match->set_attribute("strand", $strand);
		$match->set_attribute("matching_seq", $matching_seq);
		$match->set_attribute("up_flank", $up_flank);
		$match->set_attribute("down_flank", $down_flank);
		$match->set_attribute("mismatches", $mismatches);
		&TreatMatch($match);
	    }
	    if ($no_overlap) {
		$seq_to_crop = $remaining_seq;
	    } elsif ($remaining_seq) {
#		&RSAT::message::Debug("cropping sequence", length($seq_to_crop), $matching_seq_length, $offset, $regular_pattern, $seq_to_crop);
		$seq_to_crop = substr($seq_to_crop,-$offset);
#		&RSAT::message::Debug("cropped sequence", length($seq_to_crop), $offset, $regular_pattern, $seq_to_crop);
	    } else {
		$seq_to_crop = "";
	    }
	}
    }
} # RegExpSearch

################################################################
# search a IUPAC pattern
#
sub IUPACsearch {
    $offset = 0;
    $match_pos = 0;
    
    if ($strand eq "R") {
	$IUPAC_pattern = &ExpandSeq($RC_pattern);
    } else {
	$IUPAC_pattern = &ExpandSeq($pattern->get_attribute("sequence"));
    }
    $pattern_len = length($IUPAC_pattern);
    
    do {
	($match_pos,$matching_seq,$mismatches) = &NextMatch($current_seq, $IUPAC_pattern, $allowed_subst, $offset);
	unless ($match_pos == -1) {
	    $match_count++;
	    if ($strand eq "DR") {
		$match_count++;
	    }
	    
	    unless ($return_fields{counts}) {
		if ($strand eq "R") {
		    $matching_seq = &ReverseComplement($matching_seq);
		} 
		$start_pos = $match_pos -$orig_pos;
		$end_pos = $start_pos + $pattern_len -1;
		
		my $match = new RSAT::match();
		$match->set_attribute("pattern_id", $pattern->get_attribute("id"));	
		$match->set_attribute("pattern_seq", $pattern->get_attribute("sequence"));
		$match->set_attribute("expression", $IUPAC_pattern);
		$match->set_attribute("type", "IPUAC");
		$match->set_attribute("sequence_id", $sequence_id);
		$match->set_attribute("start_pos", $start_pos);
		$match->set_attribute("end_pos", $end_pos);
		$match->set_attribute("strand", $strand);
		$match->set_attribute("mismatches", $mismatches);
		$match->set_attribute("matching_seq", $matching_seq);
		&TreatMatch($match);
	    }
	    if ($no_overlap) {
		$offset = $match_pos + $pattern_len;
	    } else {
		$offset = $match_pos;
	    }
	} 
    } until ($match_pos == -1);
} # IUPACsearch


################################################################
## Treat a new match: either print it or store it if merge option has
## been activated
sub TreatMatch {
    my ($match) = @_;


    ################################################################
    ## Calculate match score
    if (($search_method eq "sliding window") ||
	($score_column > 0)) {
	$score = $pattern->get_attribute("score");
    } else {
	$match_length = length($matching_seq);
	$score = ($match_length - $mismatches)/$match_length;
    }
    $match->force_attribute("score", $score);

    return if ((defined($threshold)) && ($score < $threshold));


    ################################################################
    ## Store or print depending on the merge option
    if ($merge_matches) {
	warn join ("\t", 
		   "Storing new match", 
		   $match->get_attribute("sequence_id"), 
		   $match->get_attribute("pattern_id"), 
		   $match->get_attribute("strand"), 
		   $match->get_attribute("start_pos"), 
		   $match->get_attribute("end_pos"), 
		   $match->get_attribute("matching_seq"), 
		   $score, 
		   ), "\n" if ($main::verbose >= 5);
	push @matches, $match;
    } else {
	&PrintMatchLocation($match);
    }
    
}

################################################################
## Merge overlapping matches
sub MergeMatches {
    my (@matches) = @_;
    my @merged_matches = ();

    &RSAT::message::Info(join "\t", "Merging matches", @matches) if ($main::verbose >= 3);

    ## Check that there are at least two patterns
    unless (scalar(@matches) >= 2) {
	return @matches;
    }
    
    ## index starting positions
    my %start = ();
    foreach my $match (@matches) {
	$start{$match} = $match->get_attribute("start_pos");
    }

    ## Sort matches according to the start position
    @matches = sort {$start{$a} <=> $start{$b}} @matches;
    my $last_match = $matches[0];
    for my $m (1..$#matches) {
	$current_match = $matches[$m];
	if ($current_match->get_attribute("start_pos") <= $last_match->get_attribute("end_pos")) {
#  	    warn join( "\t", "Merging", 
#  		       "last",
#  		       $last_match->get_attribute("matching_seq"),
#  		       $last_match->get_attribute("start_pos"),
#  		       $last_match->get_attribute("end_pos"),
#  		       "current",
#  		       $current_match->get_attribute("matching_seq"),
#  		       $current_match->get_attribute("start_pos"),
#  		       $current_match->get_attribute("end_pos"),
#  		       ), "\n" if ($main::verbose >= 10);

	    ## Set the ID to "merged"
	    $last_match->force_attribute("pattern_id", "merged");
	    $last_match->force_attribute("pattern_seq", "merged");
	    
	    ## merged score is the maximum score
	    $last_match->force_attribute("score", &max($last_match->get_attribute("score"),
						     $current_match->get_attribute("score")));
	    
	    ## Merged strand is the sum of last and current strands
	    unless ($last_match->get_attribute("strand") eq 
		    $current_match->get_attribute("strand")) {
		$last_match->force_attribute("strand", "DR");
	    }
	    
	    ## calculate negative offset to take the end of the sequence
	    my $offset = $last_match->get_attribute("end_pos") 
		- $current_match->get_attribute("end_pos");

	    ## If right match extends wider than left match, extend left match
	    if ($offset < 0) {
		
		my $extension = substr($current_match->get_attribute("matching_seq"), $offset);
		
		## extend the sequence
		my $merged_sequence = $last_match->get_attribute("matching_seq");
		$merged_sequence .= $extension;
		&RSAT::message::Debug(
		    "offset", 
		    $offset, 
		    "last",
		    $last_match->get_attribute("matching_seq"), 
		    $last_match->get_attribute("start_pos"), 
		    $last_match->get_attribute("end_pos"), 
		    "current",
		    $current_match->get_attribute("matching_seq"), 
		    $current_match->get_attribute("start_pos"), 
		    $current_match->get_attribute("end_pos"), 
		    $offset, 
		    $extension, 
		    $merged_sequence), if ($main::verbose >= 10);
		$last_match->force_attribute("matching_seq", $merged_sequence);
		
		## position
		$last_match->force_attribute("end_pos",$current_match->get_attribute("end_pos"));
		
		## downstream flank
		$last_match->force_attribute("down_flank",$current_match->get_attribute("down_flank"));
		
	    }
#  	    warn join( "\t", "Merged match", 
#  		       $last_match,
#  		       $last_match->get_attribute("matching_seq"),
#  		       $last_match->get_attribute("start_pos"),
#  		       $last_match->get_attribute("end_pos")),"\n" if ($main::verbose >= 10);
	} else {
	    push @merged_matches, $last_match;
	    $last_match = $current_match;
	}
    }
    push @merged_matches, $last_match;
    
    return @merged_matches;
}


################################################################
## Print a list of matches
sub PrintMatchLocations {
    my @matches = @_;
    foreach my $match (@matches) {
	&PrintMatchLocation($match);
    }
}

################################################################
# Print a single match location
sub PrintMatchLocation {
    my ($match) = @_;
    my $matching_seq = uc($match->get_attribute("matching_seq"));

    my $strand = $match->get_attribute("strand");
    
    if ($match->get_attribute("type") eq "regexp") {
	my $up_flank = $match->get_attribute("up_flank");
	my $down_flank = $match->get_attribute("down_flank");
	if ($strand eq "R") {
	    $matching_seq = &SmartRC($matching_seq);
	    $right_flank = &ReverseComplement($down_flank);
	    $left_flank = &ReverseComplement($up_flank);
	} else {
	    $right_flank = $up_flank;
	    $left_flank = $down_flank;
	}
	
	## Append flanking
	$matching_seq = join ("", lc($right_flank),
			       uc($matching_seq),
			       lc($left_flank),
			       );
    }

    if ($match_format eq "fasta") {
	#### fasta identifier line
	print $out ">";
	print $out join ("_", 
			 $match->get_attribute("sequence_id"),
			 $match->get_attribute("strand"),
			 $match->get_attribute("start_pos"),
			 $match->get_attribute("end_pos"),
			 $match->get_attribute("pattern_id"),
			 );
	printf $out (" score: %.2f", $score);
	print $out " pattern: ", $pattern->get_attribute("sequence");
	print $out "\n";
	print $out $matching_seq, "\n";
    } else {
	print $out join ("\t", 
			 $match->get_attribute("pattern_id"),
			 $match->get_attribute("strand"),
			 $match->get_attribute("pattern_seq"),
			 $match->get_attribute("sequence_id"),
			 $match->get_attribute("start_pos"),
			 $match->get_attribute("end_pos"),
			 $matching_seq,
			 sprintf ("%.2f", $match->get_attribute("score")),
			 ), "\n";
    }
}


################################################################
## Option list
sub ShortHelp	{
    open HELP, "|more";
    print HELP <<EndShortHelp;
dna-pattern options
-------------------
-h		complete help message
-help		short help message
-p		pattern
-pl		pattern list file
-i		sequence file. 
-mask upper|lower	mask upper- or lowercases, respectively
-subst		allowed substitutions
-noIUPAC	the pattern is considered as a standard regular expression. 
-sc		score column
-o		output file.
-format		input format (raw, filelist or IG)
-id		pattern identifier (one word). 
-noid		use pattern sequence as id
-noov		prevent detection of overlapping pattern
-2str		search matches on both strands (default)
-1str		search matches on the Direct strand only
-R		search matches on the Reverse complementary strand only
-match_format	format for returning matches (supported: fasta, table)
-return		field(s) to return. Supported: $supported_return_fields
-pos		return match positions (default). Obsolete: use '-return sites' instead.
-limit 		return start and end positions for each input sequence. Obsolete: use '-return limits' instead. 
-c		return the count of matches for each pattern in each sequence. Obsolete: use '-return counts' instead.
-table		return a table with the count of pattern matches per sequence. Obsolete: use '-return table' instead.
-colsum		return total occ per sequence in the count table. Obsolete: use '-return colsum' instead.
-rowsum		return total occ per pattern in the count table. Obsolete: use '-return rowsum' instead.
-total		return total occ per sequence and per pattern in the count table. Obsolete: use '-return total' instead. 
-stats		return matching statistics. Obsolete: use '-return stats' instead.
-ct		return total count in all sequences? Obsolete: use '-return ct' instead.
-N #		return matching sequences with # flanking nucleotides. 
-NL #		return matching sequences with # left flanking nucleotides
-NR #		return matching sequences with # right flanking nucleotides
-merge		merge mutually overlapping matches.
-window		sliding window size
-top		only return the top score
-sort		sort sequences according to their top score
-th		threshold on occurrences: only return sequences with >= # pattern occurrences.
-v		verbose
-origin		origin (position 0)
EndShortHelp
    close HELP;
    exit(0);
}


################################################################
#
# Read command line arguments
#
sub ReadArguments {
    my $arg = "";
    
    my @arguments = @ARGV; ## create a copy to shift, because we need ARGV to report command line in &Verbose()
    

    while ($arg = shift (@arguments)) {

#    foreach $a (0..$#ARGV) {
	if ($arg eq "-h") {
	    &Help;
	} elsif  ($arg eq "-help") {
	    &ShortHelp;
	    
	} elsif ($arg eq "-v") {
	    if (&IsNatural($arguments[0])) {
		$main::verbose = shift(@arguments);
	    } else {
		$main::verbose = 1;
	    }

	} elsif ($arg =~ /^-ori/) {
	    $main::origin = shift(@arguments);
	    &RSAT::error::FatalError("$main::origin. Invalid origin, should be an Integer number.")
		unless (($main::origin eq "-0") || (&RSAT::util::IsInteger($main::origin)));
	    
	} elsif ($arg eq "-subst") {
	    $allowed_subst = shift @arguments;
	    &RSAT::error::FatalError("$allowed_subst. Invalid number of substitutions, should be a Natural number.")
		unless (&RSAT::util::IsNatural($allowed_subst));
	    if ($allowed_subst > 0) {
		$search_method = "IUPAC";
		&RSAT::message::Info("Seach method: IUPAC") if ($verbose >=1);
	    }
	    
	} elsif ($arg eq "-IUPAC") {
	    $search_method = "IUPAC";
	    warn "; Seach method: IUPAC\n" if ($verbose >=1);
	    
	    ################################################################
	    #### pattern specification
	} elsif ($arg eq "-id") {
	    # directly read pattern identifier from the command line
	    $pattern_id = shift(@arguments);
	    
	} elsif ($arg eq "-p") {
	    # directly read pattern sequence from the command line
	    $pattern_seq = shift(@arguments);
	    &RSAT::message::Info ("Pattern sequence", $pattern_seq) if ($verbose >=4);
	    
	    # read name of file containing the list of patterns and check for its existence
	} elsif ($arg eq "-pl") {
	    $pattern_file = shift(@arguments);;
	    &RSAT::error::FatalError("Cannot read pattern file '$pattern_file'.") 
		unless (-r $pattern_file);

	    #### score column in the pattern file
	} elsif (($arg eq "-sc") && (&IsNatural($ARGV[$a+1])) && ($ARGV[$a+1] > 1)) {
	    $score_column = shift(@argments);
	    &RAT::error::FatalError($score_column, "Invalid value for the score column: should be a Natural number") 
		unless (&IsNatural($score_column));
	    
	    #### the pattern file contains no identifier
	} elsif ($arg eq "-noid") {
	    $noid = 1;
	    
	    	    #### the pattern file contains no identifier
	} elsif ($arg eq "-noIUPAC") {
	    $noIUPAC = 1;
	    
	    ################################################################
	    #### sequence file
	} elsif ($arg eq "-i") {
	    # read input file name (sequence file)
	    $inputfile = shift(@arguments)
	    
	} elsif ($arg eq "-format") {
	    # read input format (sequence format)
	    $in_format = lc(shift(@arguments));
	    
	    
	    ################################################################
	    #### output file
	} elsif ($arg eq "-o") {
	    $outputfile = shift(@arguments);

	    ################################################################
            #### matching options

	    #### strands
	} elsif (($arg eq "-1str") ||
		 ($arg eq "-D") ||
		 ($arg eq "-W") || 
		 ($arg eq "-1str")) {
	    $strands_to_search = "D";
	} elsif (($arg eq "-R") ||($arg eq "-C")) {
	    $strands_to_search = "R";
	} elsif (($arg eq "-2str") || 
		 ($arg eq "-DR") || 
		 ($arg eq "-RD") ||
		 ($arg eq "-CW") ||
		 ($arg eq "-CW") ||
		 ($arg =~ /-2str/)
		 ) {
	    $strands_to_search = "DR";
	    
	    #### threshold
	} elsif ($arg eq "-th") {
	    $threshold = shift(@arguments);
	    unless (&IsReal($threshold)) {
		&RSAT::error::FatalError("Threshold must have a real value");
	    }

	    #### merge matches
	} elsif ($arg eq "-merge") {
	    $merge_matches = 1;
	    
	    #### no overlap
	} elsif ($arg eq "-noov") {
	    $no_overlap = 1;
	    
	    ################################################################
            #### output 
	    
	    #### match format
	} elsif ($arg eq "-match_format") {
	    $match_format = shift(@arguments);

	    ### Return fields
        } elsif ($arg eq "-return") {
	    $arg = shift (@arguments);
            chomp($arg);
            my @fields_to_return = split ",", $arg;
            foreach my $field (@fields_to_return) {
		$field = lc($field);
                if ($supported_return_fields{$field}) {
                    $return_fields{$field} = 1;
                    $calc{$field} = 1;
                } else {
                    &RSAT::error::FatalError(join("\t", $field, "Invalid return field. Supported:", $supported_return_fields));
		}
	    }


	    #### matching positions
	} elsif ($arg eq "-pos") {
	    &RSAT::message::Warning("'dna-pattern -pos' is obsolete, use '-return sites' instead");
	    $return_fields{sites} = 1;

	    ## Report sequence limits
	} elsif ($arg =~ /^-limit/) {
	    &RSAT::message::Warning("'dna-pattern -limit' is obsolete, use '-return limits' instead");
	    $return_fields{limits} = 1;
	    
	    #### count matches
	} elsif ($arg eq "-c") {
	    &RSAT::message::Warning("'dna-pattern -c' is obsolete, use '-return counts' instead");
	    $calc{counts} = 1;
	    $return_fields{counts} = 1;
	    
	    #### sum matches over all sequences
	} elsif ($arg eq "-ct") {
	    &RSAT::message::Warning("'dna-pattern -ct' is obsolete, use '-return ct' instead");
	    $return_fields{counts} = 1;
	    $return_fields{sum_only} = 1;
	    
	    #### return results in a sequence x pattern_count table
	} elsif ($arg eq "-table") {
	    &RSAT::message::Warning("'dna-pattern -table' is obsolete, use '-return table' instead");
	    $calc{counts} = 1;
#	    $return_fields{sum_only} = 0;
	    $return_fields{table} = 1;

	    #### add to the output table  a row containing the sum of each column
	} elsif ($arg eq "-colsum") {
	    &RSAT::message::Warning("'dna-pattern -colsum' is obsolete, use '-return colsum' instead");
	    $return_fields{colsum} = 1;

	    #### add to the output table a column containing row sums
	} elsif ($arg eq "-rowsum") {
	    &RSAT::message::Warning("'dna-pattern -rowsum' is obsolete, use '-return rowsum' instead");
	    $return_fields{rowsum} = 1;


	    #### add a column and a row for totals to the output table
	} elsif ($arg eq "-total") {
	    &RSAT::message::Warning("'dna-pattern -total' is obsolete, use '-return total' instead");
	    $return_fields{colsum} = 1;
	    $return_fields{rowsum} = 1;

	    #### return a summary of matching statistics 
	} elsif ($arg eq "-stats") {
	    &RSAT::message::Warning("'dna-pattern -stats' is obsolete, use '-return stats' instead");
	    $calc{counts} = 1;
	    $calc{colsum} = 1;
	    $calc{rowsum} = 1;
	    $return_fields{stats} = 1;

	    #### matching profiles
	} elsif ($arg =~ /-prof/) {
	    &RSAT::message::Warning("'dna-pattern -profiles' is obsolete, use '-return profiles' instead");
	    $return_fields{profiles} = 1;

	    #### sliding window
	} elsif ($arg =~ /^-win/) {
#	    die;
	    $search_method = "sliding window";
	    $sliding_window_size = shift(@arguments);
	    unless (&IsNatural($sliding_window_size)) {
		&RSAT::error::FatalError( "Sliding window size must be a natural number");
	    }
	    unless ($sliding_window_size > 0) {
		&RSAT::error::FatalError( "Sliding window size must be > 0");
	    }

	    #### top score
	} elsif ($arg eq "-top") {
	    $return_fields{top} = 1;
	    #### sort
	} elsif ($arg eq "-sort") {
	    $sort = 1;

	    ## mask
	} elsif ($arg eq "-mask") {
	    $mask = shift(@arguments);
	    &CheckMask($mask);

	    #### flanking (return flanking residues)
	} elsif ($arg eq "-N") {
	    $left_flanking = $right_flanking = shift(@arguments);
	    &RAT::error::FatalError($left_flanking, "Invalid value for the number of flanking residues: should be a Natural number") 
		unless (&IsNatural($left_flanking));

	} elsif ($arg eq "-NL") {
	    $left_flanking = shift(@arguments);
	    &RAT::error::FatalError($left_flanking, "Invalid value for the number of flanking residues: should be a Natural number") 
		unless (&IsNatural($left_flanking));

	} elsif ($arg eq "-NR") {
	    $right_flanking = shift(@arguments);
	    &RAT::error::FatalError($right_flanking, "Invalid value for the number of flanking residues: should be a Natural number") 
		unless (&IsNatural($right_flanking));
	    
	}
    }
}



################################################################
# scan the sequence with a sliding window
sub SlidingWindowSearch {
    my @pattern_lengths = keys(%pattern_lengths);
    my $min_pattern_length = &min(@pattern_lengths);
    my $max_pattern_length = &max(@pattern_lengths);


    $last_pos = $sequence_length - $min_pattern_length;

    return if ($last_pos < $sliding_window_size);

    $current_seq = lc($current_seq);
    my @scores = ();
    my $current_score = 0;
    my $previous_score = 0;
    my $score_sum = 0;
    my $top_score;

    #### initialize score vector
    for my $pos (0..($sliding_window_size-2)) {
	my @current_position_scores = ();
	for my $pattern_length (@pattern_lengths) {
	    my $subseq = substr($current_seq, $pos, $pattern_length);
	    push @current_position_scores, $current_score, $pattern_scores{$subseq};
	}
	my $current_score = &checked_max(@current_position_scores);
	push @scores, $current_score;
	$score_sum += $current_score;
    }
    $top_score = $score_sum;

    #### scan the sequence with the sliding window
    for my $pos (($sliding_window_size-1)..$last_pos) {
	my @current_position_scores = ();
	for my $pattern_length (@pattern_lengths) {
	    my $subseq = substr($current_seq, $pos, $pattern_length);
	    push @current_position_scores, $current_score, $pattern_scores{$subseq};
	}
	my $current_score = &checked_max(@current_position_scores);
	push @scores, $current_score;
	$score_sum += $current_score;
	
#	warn join( "\t", $sliding_window_size, $last_pos, $subseq, $current_score, $score_sum, $threshold), "\n" if ($current_score);
	if ($score_sum >= $threshold) {
	    $pattern->force_attribute("score", $score_sum);
	    $end_pos = $pos - $orig_pos + $pattern_length ;
	    $start_pos = $pos - $orig_pos - $sliding_window_size +2;
	    $matching_seq = substr($current_seq, $start_pos, $sliding_window_size + $pattern_length - 1);
	    &PrintMatchLocation() if ($return_fields{sites});
	    $profile_score{$sequence_id}{$start_pos} = $score_sum if ($return_fields{profiles});
#	    die $profile_score{$sequence_id}{$start_pos};
	}
	
	$previous_score = shift @scores;
	$score_sum -= $previous_score;
	$top_score = &max($top_score, $score_sum);
    }
    if ($top_score >= $threshold) {
	$top_score{$sequence_id} = $top_score;
    }
}


################################################################
#
# Report sliding window profiles
#
sub MatchProfiles {
    
    ################################################################
    #### calculate min and max positions
    warn "; Calculating min and max position\n" if ($verbose >= 2);
    for my $id  (@sequence_ids) {
	my %matches = %{$profile_score{$id}};
	$min_pos = &min($min_pos, keys %matches);
	$max_pos = &max($man_pos, keys %matches);
    }

    #### print header
    print $out join( "\t", 
		     "; position",
		     ($min_pos..$max_pos)
		     ), "\n";

    warn "; Printing matching profiles\n" if ($verbose >= 2);
    #### print profiles
    for my $id  (@sequence_ids) {
	my %matches = %{$profile_score{$id}};
	my @sites = sort {$a <=> $b} keys %matches;
	print $out join( "\t", 
			 $id,
			 @matches{@sites}, 
			 ), "\n";
    }
}


################################################################
# Verbosity: report parameters
# 
sub Verbose {
    print $out "; dna-pattern ";
    &PrintArguments($out);
    print $out "; Citation: van Helden et al. (2000). Yeast 16(2), 177-187.\n";
    printf $out "; %-21s\t%s\n", "Input file", $inputfile if ($inputfile);
    printf $out "; %-21s\t%s\n", "Input format", $in_format; 
    printf $out "; %-21s\t%s\n", "Output file", $outputfile if ($outputfile);
    printf $out "; %-21s\t%s\n", "Pattern file", $pattern_file if ($pattern_file);
    printf $out "; %-21s\t%s\n", "Search method", $search_method;
    if ($search_method eq "sliding window") {
	printf $out "; %-21s\t%s\n", "Sliding window", $sliding_window_size;
	printf $out "; %-21s\t%s\n", "Pattern length", $pattern_length;
    }
    
    printf $out "; %-21s\t%g\n", "Threshold", $threshold;
    printf $out "; %-21s\t%d\n", "Allowed substitutions", $allowed_subst;
    printf $out "; Return fields\n";
    foreach $key (keys %return_fields) {
	printf $out ";%-21s\t%s\n", "",$key;
    }
    print $out "; Patterns\n";
    print $out "; \tseq\tid\tscore\n";
    foreach my $pattern (@patterns) {
	print $out ("; ", 
		    "\t", $pattern->get_attribute("sequence"),
		    "\t", $pattern->get_attribute("id"),
		    "\t", $pattern->get_attribute("score"),
		    "\n");
    }
    print $out "; \n";

    if ($return_fields{sites}) {
	print $out "; Matching positions\n";
	
	unless ($match_format eq "fasta") {
	    print $out join ("\t", 
			     "; PatID",
			     "Strand",
			     "Pattern",
			     "SeqID",
			     "Start",
			     "End",
			     "matching_seq",
			     "Score"), "\n";
	}
    }
}





################################################################
# Matching statistics
#
sub MatchingStatistics {
    my $nb_sequences = $#sequence_ids + 1;
    my $nb_patterns = $#patterns + 1;
    my $matching_patterns = 0;
    my $matching_patterns_pct = 0;
    my $max_matching_score_pct = 0;
    my $max_matching_score;
    my $max_score;
    foreach my $pattern (@patterns) {
	$max_score = &max($max_score, $pattern->get_attribute("score"));
	if ($sum_per_pattern{$pattern} > 0) {
	    $matching_patterns++ ;
	    $max_matching_score = &max($max_matching_score, $pattern->get_attribute("score"));
	}
    }
    if ($nb_patterns > 0) {
	$matching_patterns_pct =  100*$matching_patterns/$nb_patterns;
    }

    if ($max_score > 0) {
	$max_matching_score_pct =  100*$max_matching_score/$max_score;
    }

    my $matched_sequences = 0;
    my $matched_sequences_pct = 0;
    foreach my $sequence_id (@sequence_ids) {
	$matched_sequences++ if ($sum_per_sequence{$sequence_id} > 0);
    }
    if ($nb_sequences > 0) {
	$matched_sequences_pct = 100*$matched_sequences/$nb_sequences;
    }

    print $out "; Matching statistics\n";

    printf $out ( "%-21s\t%s\t%s\t%s\n", 
		  "; statistics",
		  "max",
		  "matched",
		  "percent"
		  ), "\n";
    printf $out ( "%-21s\t%d\t%d\t%.1f\n", 
		  "matching patterns",
		  $nb_patterns,
		  $matching_patterns,
		  $matching_patterns_pct
		  );
    printf $out ( "%-21s\t%.2f\t%.2f\t%.1f\n", 
		  "matching scores",
		  $max_score,
		  $max_matching_score,
		  $max_matching_score_pct
		  );
    printf $out ( "%-21s\t%d\t%d\t%.1f\n", 
		  "matching sequence",
		  $nb_sequences,
		  $matched_sequences,
		  $matched_sequences_pct
		  );
}

################################################################
# print the matching table (patterns/sequences)
sub CountTable {

    ## Print the header of the count table
    print $out "#seq";
    print $out "\t", "rank" if ($return_fields{rank});	
    print $out "\t", "score" if ($return_fields{scores}); 
    print $out "\t", "total" if ($return_fields{rowsum}); 
    if ($return_fields{table}) {
	foreach my $pattern (@patterns) {
	    print $out "\t", $pattern->get_attribute("id");
	}
    }
    print $out "\n";

    ## Sort sequences according to total score or sum of pattern counts
    if ($sort) {
      if ($return_fields{scores}) {
	@sequence_ids = sort {$score_per_sequence{$b} <=> $score_per_sequence{$a}} @sequence_ids;
      } else {
	@sequence_ids = sort {$sum_per_sequence{$b} <=> $sum_per_sequence{$a}} @sequence_ids;
      }
    }

    ## Print scores and counts per sequence
    my $total_score = 0;
    my $rank = 0;
    foreach $sequence_id (@sequence_ids) {
      $rank++;
      print $out $sequence_id;
      print $out "\t", $rank if ($return_fields{rank});	

      if ($return_fields{scores}) {
	$total_score += $score_per_sequence{$sequence_id};
	print $out "\t", $score_per_sequence{$sequence_id};
      }
      print $out "\t", $sum_per_sequence{$sequence_id} if ($return_fields{rowsum});
      if ($return_fields{table}) {
	foreach my $pattern (@patterns) {
	  print $out "\t", $match_count{$sequence_id}{$pattern};
	}
      }
      print $out "\n";
    }

    #### print total of occurrences per pattern
    if ($return_fields{colsum}) {
      print $out "total";
      print $out "\t", $rank if ($return_fields{rank});	
      print $out "\t", $total_score if ($return_fields{scores});
      print $out "\t", $total_sum if ($return_fields{colsum});
      foreach my $pattern (@patterns) {
	print $out "\t", $sum_per_pattern{$pattern};
      }
      print $out "\n";
    }
}

################################################################
# match counts
sub MatchCounts {
    if ($return_fields{sum_only}) {
	print $out "; Counts per pattern\n";
	print $out "; PatID\tPattern\tMatches\n";
	foreach my $pattern (@patterns) {
	    print $out $pattern->get_attribute("id");
	    print $out "\t", $pattern->get_attribute("sequence");
	    print $out "\t", $sum_per_pattern{$pattern};
	    print $out "\ttotal";
	    print $out "\n";
	}

    } else {
	print $out "; Counts per sequence and per pattern\n";
	print $out "; SeqID\tPatID\tPattern\tMatches\n";
	foreach $sequence_id (@sequence_ids) {
	    foreach $pattern (@patterns) {
		if ($match_count{$sequence_id}{$pattern} >= $threshold) {
		    print $out join ("\t", "$sequence_id",
				     $pattern->get_attribute("id"),
				     $pattern->get_attribute("sequence"),
				     $match_count{$sequence_id}{$pattern}
			), "\n";
		}
	    }
	}
    }
}

################################################################
## Match scores
sub MatchScores {
    print $out "; Score per sequence\n";
    print $out "; SeqID\tcounts\tscore\n";
    foreach $sequence_id (@sequence_ids) {
	if ($match_count{$sequence_id}{$pattern} >= $score_threshold) {
	    print $out join ("\t", "$sequence_id",
		), "\n";
	}
    }
}

################################################################
# top scores
sub TopScores {
    print $out "; Top score per sequence (sliding window)\n";
    print $out "; SeqID\ttop\n";
    if ($sort) {
	@sequence_ids = sort {$top_score{$b} <=> $top_score{$a}} @sequence_ids;
    }
    foreach $sequence_id (@sequence_ids) {
	printf $out  "$sequence_id\t%f\n", $top_score{$sequence_id};
    }
}

############ HELP message ####################
sub Help	{
    open HELP, "|more";
    print HELP <<EndOfHelp;
NAME
	dna-pattern
	perl script v1.1 by Jacques van Helden, 30 July 1997.

DESCRIPTION
	Searches all occurrences of a pattern within DNA sequences.
        The pattern can be entered as a simple nucleotide sequence, 
        but can also include degenerate nucleotide codes, or regular 
        expressions. 

CATEGORY
	sequences
	pattern matching

USAGE
	(get help)
	dna-pattern -h

	(directly enter the sequence to search)
	dna-pattern  -i sequencefile -format seq_format -p pattern [-id identifier] 
			[-1str|-2str|-R] [-c|-ct] [-noov]
			[-N flanking] [-v]

	(read a list of patterns from a file)
	dna-pattern -i sequencefile -format seq_format -pl pattern_file 
   			[-1str|-2str|-R] [-c|-ct]  [-noov] 
   			[-N flanking] [-v]

ARGUMENTS
	-h	help (displays the current message)

	-help	short help message

	-i	input sequence file. This file contains the sequences where the pattern(s)
		will be searched for. 
		Various format are accepted
		If omitted, standard input (eg keyboard) will be used. 
		This allows to use the program within a pipe.

	-mask upper|lower
		Mask lower or uppercases, respecively, i.e. replace
		selected case by N characters.

	-format	input sequence format. The accepted formats are
		fasta	       FastA format
		IG	       IntelliGenetics format
		raw	       a single sequence in a file
		multi	       each new line is a new sequence
		filelist       a list of files containing each 
			       a single raw sequence
	-o	output file.
		If omitted, standard output (eg screen) will be used. 
		This allows to use the program within a pipe.

	-p	pattern entered directly after -p. 
		Alternatively use -pl.

	-pl	name of the file containing the patterns to search .
		(see format below)

	-subst #
               allow # substitutions. 
	-noIUPAC	
		The pattern is considered as a standard regular expression. 
		It is convenient to specifically search for masked sequences represented
		by "N" characters in sequences:
		ie : dna-pattern -i your_sequence_file -p "N+" -noov -1str -noIUPAC
	-sc #	
		score column

		the #th column of the pattern file contains a number
		indicating the score for a match of this pattern. This
		option allows to weight the matches according to a
		user-defined scheme.

	-noid	
		do not search pattern identifier in the second column
		of pattern file. instead the id takes the same content
		as the pattern sequence.

	-noov
		Do not count overlapping matches for self-overlapping
		patterns.

	-2str	search matches on both strands (direct and reverse complement)

	-1str	search matches only on the direct strand.

	-R 	search matches only on the reverse complement strand.

	-id	pattern identifier (one word). 
		Use this option combined with -p, to specify the ID of
		a unique pattern entered on the command line. For
		multple patterns, it is more convenient to use a
		pattern file (option -pl).

	-return field1[,field2,...]

		List of fields to return. Multiple fields can be
		entered separated by commas, or by using iteratively
		the option.
		    -return field1 [-return field2 ...]

		Supported fields: $supported_return_fields.

		-return sites:   return match positions (default)

		-return limits: return start and end positions for each
		    input sequence
		    
		-return notacgt: return positions for characters that
		do not correspond not standard nucleotides (ACGT) eg: N, X and 
		degenerate nucleotides from IUPAC code (eg: W, K)

		-return counts: return the count of matches per
		    sequence.  

		-return rank: return the rank of the sequence (this is
                     especially useful in combination with the option
                     -sort).

		-return score: return a score per sequence, computed
                     by summing the scores of the matching patterns.

		-return ct:    same as '-return counts', except that it
		    returns the sum of matches in all the files of the
		    sequence file list, instead of the count within
		    each separate file.

		-return table: return the count of pattern matches per
		    sequence in the form of a table.  (one line per
		    sequence, one column per pattern)

		-return colsum (together with -return table) prints an extra
		    column with the total occurrences per sequence

		-return rowsum (together with -return table) prints an
		    extra row with total occurrences per pattern

		-return total (together with -return table) prints an
		    extra column with the total occurrences per
		    sequence and an extra row with total occurrences
		    per pattern.  (amounts to combine -colsum and
		    -rowsum)

		-return stats return matching statistics

		-return profiles return matching profiles with sliding
                    windows.

	-match_format	
		format for returning matches (supported: fasta, table)

        -th #   Threshold. 
                Return match count only for sequences with >= # matches.
                Only valid in combination with -c.

	-merge  merge mutually overlapping matches. When succesive
		matches overlap, they are converted into a single
		match. The merged match takes the ID "merged". The
		score is the highest score of the matching patterns.

	-N #	return matching sequences with # flanking nucleotides

	-NL #	return matching sequences with # left flanking nucleotides

	-NR #	return matching sequences with # right flanking nucleotides

	-v	verbose.

        -origin #
                define # as the origin for the calculation of positions.
                -origin -0 defines the end of each sequence as the 
                origin. The matching positions are then negative values, 
                providing the distance between the match and the end of the 
                sequence.

	-window #	
		Sliding window size. The score at each position is
		calculated by summing the scores of all patterns
		encountered within a sliding window of size #. This
		option automatically returns matching positions. 
		A threshold can be specified to specify the minimal
		matching score to be returned.

	-top	(with sliding window only)
		only return the top score obtained with the sliding
		window for each sequence.

	-sort	(with -top only)
		sort sequences according to their top score

PATTERN FORMATS

    PATTERN SEQUENCE

	The standard degenerate nucleotide code of the IUPAC-IUB
	commission is supported (http://www.iupac.org/, see
	http://www.chem.qmw.ac.uk/iupac/misc/naseq.html for complete
	information).

	The pattern sequence should thus only contain the following characters:

            ------------------------------------------------------
            Symbol  Nucleotide(s)   Description
            ------------------------------------------------------
            A       A               Adenosine
            C       C               Cytidine
            G       G               Guanosine
            T       T               Thymidine
            R       A or G          puRines
            Y       C or T          pYrimidines
            W       A or T          Weak hydrogen bonding
            S       G or C          Strong hydrogen bonding
            M       A or C          aMino group at common position
            K       G or T          Keto group at common position
            H       A, C or T       not G
            B       G, C or T       not A
            V       G, A, C         not T
            D       G, A or T       not C
            N       G, A, C or T    aNy
            ------------------------------------------------------

	Upper and lower case are considered equivalent.

	Patterns can either be entered directly by the user, or listed
	in a file.

        The pattern can also contain regular expression elements:
        - GAT\[TA\]AG means \"GATAAG or GATTAG\" (equivalent to GATWAG).
        - CGGN{11}CCG means CGG followed by 10 N followed by CCG.
        - GATAAGN{0,30}GATAAG means two GATAAG spaced by 0 to 30 
          nucleotides.

    DIRECT PATTERN INPUT

	Type the -p option directly followed by a pattern sequence. 
	An optional identifier can be further entered after the -id option.

    PATTERN FILE

	A pattern file is a tab-delimited text file. Each row contains
	the description of one pattern. Column content:
	  1) Pattern sequence. This is the only mandatory column.
	  2) Pattern ID (optional).
	Additional columns can be used to specify other pattern
	attributes (description, score, ...), but they are by default
	ignored by the program. The option -sc allows to specify a
	score column.

SEQUENCE FILE FORMAT
        Different formats are supported:
        - raw
	- wc (=wconsensus)
        - filelist
        - IG (intelligenetics)

	raw	The input file must contain raw sequences without any 
                comment or other text. Tabs (\\t), blank spaces and newline 
                characters (\\n) are accepted (they will be automatically 
                removed before analysis). The sequence must be terminated by 
                a newline character.
	
	filelist	
		file list. Each line of the input file contains the 
		name of a file containing a single sequence in raw format.

	IG	IntelliGenetics format. 	
 		The first non-comment line must be the sequence identifier 
		(a single word without spaces). 
		The sequence follows the identifier line identifier. It can 
                include spaces, tabs or newlines, that will be removed for 
                sequence analysis.
                The end of one sequence is indicated by termination character:
		1 for linear, 2 for circular sequences. 
		A single file may contain several sequences. 

		EXAMPLE of IG suite:

		; sequence of the region upstream from NIL1
	        ; Locus GAT1
 	        ; ORF YFL021W  coord:   6 95964 97496
 	        ; upstream region size: 100
 	        ; upstream region coord:        6 95864 95963
 	        GAT1
 	        ACAGAGCAACAATAATAACAGCACTATGAGTCGCACACTT
  	        GCGGTGCCCGGCCCAGCCACATATATATAGGTGTGTGCCA
  	        CTCCCGGCCCCGGTATTAGC
  	        1
 	        ; sequence of the region upstream from PUT4
                ; Locus PUT4
                ; ORF YOR348C  coord:   15 988773 986890
                ; upstream region size: 100
                ; upstream region coord:        15 988873 988774
                PUT4
                GGGTTTGTGTTCCTCTTCCTTTCCTTTTTTTTTCTCTCTT
                CCCTTCCAGTTTCTTTTATTCTTTGCTGTTTCGAAGAATC
                ACACCATCAATGAATAAATC
                1	

OUTPUT
	The output file contains columns separated by tabs (\\t).

	Column contents:

	1- pattern identifier
	2- matching strand : direct (D) or reverse complement (R)
	3- pattern sequence
	4- name of the sequence matching the pattern
	5- start position of the match
	6- end position of the match
	7- match sequence
	8- matching score

	If the -c option is entered, output file returns the following
	columns :

	1- query pattern identifier word
	2- query pattern sequence
	3- sequence file name
	4- number of matches for the current pattern in the current file

EXAMPLES
	dna-pattern -i GATA -p GATWA -i my_file.fasta -c

	will count all occurences of the strings 'GATAA' and 'GATTA' present 
	in the file my_file.fasta
WEB VERSION
	http://www.bigre.ulb.ac.be/bioinformatics/rsa-tools/
EndOfHelp
    close HELP;
    exit(0);
}


################################################################
## Print the start and end positions of the sequence
sub PrintSequenceLimits {
  my ($seq_id, $seq_len, $orig_pos) = @_;
  my $start_end = new RSAT::pattern(
				    sequence_id => $seq_id,
				    pattern_id=>"START_END",
				    strand => "DR",
				    start_pos => 1-$orig_pos,
				    end_pos => $seq_len - $orig_pos,
				    pattern_seq => "-",
				    matching_seq => "-",
				    score=>0,
				   );
  &PrintMatchLocation($start_end);

#   my $seq_start = new RSAT::pattern(
# 				    sequence_id => $seq_id,
# 				    pattern_id=>"SEQ_START",
# 				    strand => "DR",
# 				    start_pos => 1-$orig_pos,
# 				    end_pos => 1-$orig_pos,
# 				    pattern_seq => "-",
# 				    matching_seq => "-",
# 				    score=>0,
# 				   );
#   &PrintMatchLocation($seq_start);

#     my $seq_end = new RSAT::pattern(
# 				    sequence_id => $seq_id,
# 				    pattern_id=>"SEQ_END",
# 				    strand => "DR",
# 				    start_pos => $seq_len - $orig_pos,
# 				    end_pos => $seq_len - $orig_pos,
# 				    pattern_seq => "-",
# 				    matching_seq => "-",
# 				    score=>0,
# 				   );
#   &PrintMatchLocation($seq_end);
}


